Review



software, algorithm rstudio  (RStudio)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    RStudio software, algorithm rstudio
    Software, Algorithm Rstudio, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/software, algorithm rstudio/product/RStudio
    Average 90 stars, based on 1 article reviews
    software, algorithm rstudio - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    software, algorithm rstudio  (RStudio)
    90
    RStudio software, algorithm rstudio
    Software, Algorithm Rstudio, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/software, algorithm rstudio/product/RStudio
    Average 90 stars, based on 1 article reviews
    software, algorithm rstudio - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    software and algorithms rstudio v1.0.143  (RStudio)
    90
    RStudio software and algorithms rstudio v1.0.143
    Software And Algorithms Rstudio V1.0.143, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/software and algorithms rstudio v1.0.143/product/RStudio
    Average 90 stars, based on 1 article reviews
    software and algorithms rstudio v1.0.143 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other  (Nikon)
    99
    Nikon algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other
    KEY RESOURCES TABLE
    Algorithms Nis Elements Ar Nikon N A Prism 7 Graph Pad Software N A R Rstudio N A Alphaview Proteinsimple N A Other, supplied by Nikon, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other/product/Nikon
    Average 99 stars, based on 1 article reviews
    algorithms nis elements ar nikon n a prism 7 graph pad software n a r rstudio n a alphaview proteinsimple n a other - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    software, algorithm rstudio version 1.1.463  (RStudio)
    90
    RStudio software, algorithm rstudio version 1.1.463

    Software, Algorithm Rstudio Version 1.1.463, supplied by RStudio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/software, algorithm rstudio version 1.1.463/product/RStudio
    Average 90 stars, based on 1 article reviews
    software, algorithm rstudio version 1.1.463 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Molecular cell

    Article Title: Targeted and Persistent 8-Oxoguanine Base Damage at Telomeres Promotes Telomere Loss and Crisis

    doi: 10.1016/j.molcel.2019.04.024

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: N/A pLKO1-puro PARP1 shRNA4 (sequence:CCGGCCGAGAAATCTCTTACCTCAACTCGAGTTGAGGTAAGAGATTTCTCGGTTTTT) Sigma MISSION® shRNA SHCLNG- {"type":"entrez-nucleotide","attrs":{"text":"NM_001618","term_id":"1519246470","term_text":"NM_001618"}} NM_001618 TRCN0000007930 Clone ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_001618.2","term_id":"11496989","term_text":"NM_001618.2"}} NM_001618.2 –1176s1c1 pLKO1-puro PARP1 shRNA5 (sequence:CCGGGCAGCTTCATAACCGAAGATTCTCGAGAATCTTCGGTTATGAAGCTGCTTTTT) Sigma MISSION® shRNA SHCLNG- {"type":"entrez-nucleotide","attrs":{"text":"NM_001618","term_id":"1519246470","term_text":"NM_001618"}} NM_001618 TRCN0000007929 Clone ID: {"type":"entrez-nucleotide","attrs":{"text":"NM_001618.2","term_id":"11496989","term_text":"NM_001618.2"}} NM_001618.2 –2715s1c1 pCMV-VSV-G Addgene, gift from Dr. Bob Weinberg Cat#8454 psPAX2 Addgene, gift from Dr. Didier Trono Cat#11260 pOGG1-EGFP plasmid Gift from Dr. Anna Campalans (CEA, France) Campalans et al., 2007 pEYFP-XRCC1 plasmid Gift from Dr. Marit Otterlei (NTNU, Normway) Fan et al., 2004 pmCherry-NEIL1 plasmid Gift from Dr. David Wilson (NIA, USA) McNeill et al., 2013 Software and Algorithms NIS Elements AR Nikon N/A Prism 7 Graph Pad software N/A R RStudio N/A AlphaView Proteinsimple N/A Other: Peptide Nucleic Acid Probes TelC-Alexa488 (CCCTAACCCTAACCCTAA) PNA Bio Cat#F1004 CENPB-Cy5 (Pan centromere probe.

    Techniques: Recombinant, Plasmid Preparation, Imaging, Clone Assay, Sequencing, shRNA, Software

    Journal: eLife

    Article Title: Convergent recruitment of TALE homeodomain life cycle regulators to direct sporophyte development in land plants and brown algae

    doi: 10.7554/eLife.43101

    Figure Lengend Snippet:

    Article Snippet: Software, algorithm , RStudio Version 1.1.463 , RStudio , RRID: SCR_000432 , http://www.rstudio.com/.

    Techniques: Software